모바일웹 | 지면보기 PDF | 2020.10.28 수요일
Hot Click
[문화] 지식카페 게재 일자 : 2016년 02월 03일(水)
‘之자’ 만취한 사람, 시간 걸리지만 결국 제 방향으로 간다
▲  일러스트 = 송재우 기자 jaewoo@munhwa.com

김범준의 과학 이야기 - ⑩ DNA 염기배열과 마구걷기

인도 위를 비틀거리며 걸어가는 술 취한 사람이 있다. 술에 만취해서, 가야 할 집이 어느 방향인지를 전혀 기억 못 해 그때그때 마구잡이로 동쪽과 서쪽 둘 중 한 방향을 택해 움직인다고 하자. 처음 위치를 0이라 하고 동쪽으로 한걸음 움직이면 현재 위치에 1을 더하고 서쪽으로 한걸음 움직이면 현재 위치에서 1을 뺀다면 시간이 지나면서 만취한 사람의 위치는 어떻게 변할까. 바로, 필자가 몸담고 있는 통계물리학 분야의 유명한 ‘마구걷기’ 문제다. ‘마구걷기’는 그때그때 마음 내키는 대로 마구잡이로 방향을 택해 걷는 경우를 다룬다는 뜻이다.

어떤 사람은 우연히 동쪽으로만 연달아 수십 걸음을 움직여 처음 위치 0에서 상당히 멀리 벗어날 수도 있고, 또 어떤 사람은 동쪽과 서쪽을 번갈아 왔다 갔다 하면서 처음 위치의 근방에 오래 머물 수도 있다. 이처럼 그때그때 결과가 달라지는 상황에서 중요한 것은 바로 ‘평균’이다. 만취한 사람을 열 명, 백 명, 천 명 식으로 점점 더 많이 모아서 이 모든 만취자의 위치에 대한 평균을 구해보는 거다. 천 명, 만 명에게 술을 살 필요는 없다. 간단한 컴퓨터 프로그램을 작성해 계산하면 결과를 얻기도 쉽고 술값도 들지 않는다. 만취자가 수백만 명이 되어도 계산이 오래 걸리지도 않는다.(컴퓨터를 이용해 이런 계산을 직접 하는 것이 어려운 분이라면 할 줄 아는 분에게 술 사주면서 프로그램을 만들어 달라고 부탁하면 된다. 한 사람 술값만 든다.)

마구걷기 실험을 해 수많은 경우에 대해 평균을 구해보면 동쪽과 서쪽 방향 중 선호하는 방향이 없으니(술이 완전히 취한 만취자임을 기억할 것) 위치의 평균을 구하면 그 값이 0이다. 사람들 하나하나가 예외 없이 처음 위치에 계속 머문다는 뜻이 아니다. 동쪽 서쪽으로 움직인 많은 사람들의 위치를 ‘평균’내면 처음 위치인 0이 된다는 거다. 백만 명의 만취자 중 절반 정도는 출발한 위치에서 동쪽에 나머지 절반 정도는 출발한 위치에서 서쪽에 있을 테니, 이들 모든 만취자 위치의 평균을 구하면 플러스와 마이너스가 상쇄되어 거의 0이 된다고 생각하면 된다. 이런 마구걷기 문제에서 사실 더 재미있는 양은 만취자가 처음 위치에서 얼마나 멀리 벗어났는지 그 거리의 평균을 구하는 거다. 만취자 한 사람의 위치는 0보다 작을 수도 클 수도 있지만, 위치 0인 곳에서부터 거리를 재면 동이나 서나 0보다 큰 값을 얻게 된다는 것이 중요하다. 즉, 위치의 평균은 동쪽 서쪽 상쇄되어 0이지만, 거리의 평균은 당연히 0보다 크다. 그리고 거리의 평균을 구할 때 많이 쓰는 방법 중 하나가 바로 위치의 표준편차(혹은 위치의 제곱평균제곱근 값)를 구하는 거다. 간단히 계산해보면 걷기 시작한 후로 시간 t가 흘렀을 때, 만취자가 처음 위치에서 벗어난 거리는 √t(=t½)에 비례한다는 것을 보일 수 있다. 거꾸로, 만약 원점에서 벗어난 거리를 재보니 √t의 꼴이 된다면 그 움직임이 마구걷기와 흡사하다고 결론을 내릴 수도 있다.

비틀비틀 만취자 말고도 비슷하게 마구걷기로 생각할 수 있는 문제들이 많다. 그 중 하나가 바로 브라운 운동이다. 식물학자 로버트 브라운은 현미경으로 꽃가루를 관찰해 꽃가루가 이리저리 움찔움찔하면서 움직인다는 것을 관찰하게 된다. 처음에는 꽃가루가 가진 모종의 ‘생명력’으로 마치 살아있는 생명처럼 스스로 움직인다고 생각했지만(정신줄 놓은 만취자도 살아서 스스로 움직이는 생명체임을 기억할 것), 이후 꽃가루가 아닌 다양한 다른 종류의(생명력이 있을 턱이 없는) 가루도 마찬가지 움직임을 보인다는 것이 관찰되었다. 브라운 운동에 대해 성공적인 설명을 정량적으로 제시한 사람이 바로 유명한 아인슈타인이다. 1905년을 물리학자들은 기적의 해라고 부른다. 그 한 해에 아인슈타인은 당시 물리학의 토대를 송두리째 바꾸게 되는 세 편의 논문을 발표한다. 빛의 속성을 새롭게 밝힌 광전 효과에 대한 논문, 시간과 공간의 기존 관념을 뒤흔들어 놓은 특수상대성 이론에 대한 논문, 그리고 바로 오늘의 주제인 마구걷기하는 브라운 입자의 운동에 대한 논문이다.

아인슈타인의 브라운 운동에 대한 이론이 중요한 이유는 꽃가루와 같은 브라운 입자가 보여주는 불규칙적인 운동이 그 입자 주변에 수없이 존재하지만 우리 눈에 직접 볼 수 없을 정도로 작은 분자들의 열적인 요동에 의해 만들어진다는 것을 명확히 보였기 때문이다. 즉, 기체나 액체의 분자가 당시 많은 과학자들이 오해했던 것처럼 일종의 허구적인 이론의 상상물이 아니라 실재한다는 것을, 현미경으로 우리 눈으로 직접 볼 수 있는 브라운 운동을 만들어 내는 물리적인 실체임을 명확히 밝혔기 때문이다. 브라운 입자의 운동처럼 마구걷기의 형태로 요동치는 것들이 우리 주변에는 참 많다. 누구나 당연히 가장 먼저 매일 매일 주가가 변하는 주식시장을 떠올릴 수 있을 거다. 주식시장에서의 주가의 흐름은 정확히 같은 것은 아니지만 마구걷기와 비슷한 성질들을 보인다. 주식시장에서 매일 매일의 주가 지수는 보통 1% 정도의 변동 폭을 가진다. 주가지수가 오르는 것은 만취자가 동쪽으로 움직인 것으로 주가지수가 내리는 것은 만취자가 서쪽으로 움직인 것으로 생각하고, 오늘의 주가지수의 오름과 내림은 같은 확률로 일어나며 어제의 오르내림과는 상관없다고 가정해 보자. 이제 주가지수의 움직임은 위에서 설명한 만취자의 움직임이 된다.

처음 비틀거리기 시작한 위치로부터 만취자의 거리가 √t에 비례한다는 것을 이용하면, 1년 동안의 주가지수의 변동 폭은 √―250 정도가 되어 15% 내외 정도가 된다는 것을 알 수 있다(변동 폭은 예측 가능하지만 오를지 내릴지의 변동의 방향은 예측할 수 없다는 것이 중요하다). 즉, 주가지수의 하루 변동 폭으로부터 일 년 변동 폭을 짐작할 수 있는 이유가 바로 주가지수가 일종의 마구걷기와 흡사하기 때문이다. (물론 매일 매일 주가지수의 오르내림이 서로 독립적이고 확률분포가 동일하며 하루의 주가 변동 폭은 1% 정도로 별로 크지 않다는 등의 가정이 필요하다. 그리고 사실 주가지수의 움직임은 브라운 운동이 아니라 기하적인 브라운 운동에 더 가깝다.)

지구 위에서 함께 살아가는 많은 생명체는 세포핵 안에 DNA를 가지고 있다. 두 줄이 서로 마주 보고 나선형으로 꼬여있는 형태인 DNA는 한 줄을 따라 죽 늘어서 있는 염기의 서열이 짝을 진 다른 줄의 염기 서열을 정확히 결정해서, 두 줄 중 한 줄의 염기 서열만을 적어서 유전정보를 표현한다. A, T, G, C의 영어 알파벳으로 적는 모두 네 종류의 염기가 있어서 한 생명체의 DNA염기서열은 “ATATTTAACACAATCGATATTAA…”처럼 엄청나게 긴 알파벳들의 나열로 적힌다. 1992년에 저명 학술지 네이처에 실린 한 논문에서는 이러한 DNA의 염기서열을 앞서 설명한 마구걷기의 방법으로 해석했다. 논문의 저자들은 배열을 따라가다가 퓨린(purine)이라는 종류의 염기인 A나 G가 나오면 가상의 입자(혹은 앞의 술 취한 사람)가 직선상에서 동쪽(+1)으로 한 칸, 피리미딘(pyrimidine) 종류인 T나 C가 나오면 서쪽(-1)으로 한 칸을 움직이게 하고는 이 입자의 위치가 시간이 지나면서 어떻게 되는지를 살펴 본거다. 여러 생명체의 DNA 염기서열을 이용해 처음 위치로부터의 거리의 평균값을 구해 ta의 꼴로 적으면 흥미롭게도 a의 값이 1/2보다 확연히 크다는 연구결과를 발표했다. 즉, DNA의 염기서열은 A, T, G, C가 마구잡이로 배열된 것이 결코 아니며 정보가 들어있음에 분명하다는 것을 간접적으로 보인 연구다. 앞에서 이야기한 주식시장의 주가에 대해서도 주가가 오르면 오른 만큼 동쪽으로 가상의 입자가 움직인 것으로 내리면 또 내린 만큼 서쪽으로 가상의 입자가 움직인 것으로 생각하면 DNA의 염기서열에서 네이처 논문의 저자들이 구한 것처럼 처음 위치로부터의 거리의 평균값을 구할 수 있다. 직접 해 보면 거리가 ta의 꼴로 변한다고 할 때 a=½에 아주 가깝다는 것을 알 수 있다. 따라서 주가의 변화는 술 취한 사람의 마구걷기와 흡사하지만, DNA의 염기서열은 결코 마구걷기로 기술될 수 없다는 얘기다.

만취한 남편을 데리러 남편이 마지막 전화한 곳에 갔더니 남편이 안 보인다. 남편을 찾기 위한 수색 반경은 얼마나 될까. 남편이 마지막 전화한 시점에서 시간 t가 지났다면, 수색반경은 t의 제곱근(√t)에 비례해, 예를 들어 한 시간 후 1㎞라면 9시간 후에는 3㎞의 식으로 늘여 가면 된다. 남편이 제정신이 남아있다면 더 찾기 어렵다. 제정신이라 특정 방향으로 걸어갔지만 그 방향을 모를 때의 수색반경은 t에 비례한다. 9시간 후에는 반경 9㎞ 안을 모두 수색해야 한다. 물론 제정신이면서 동시에 집을 향해 걸어갔다면 애초에 남편 찾아다니느라 고생할 필요도 없겠지만. (문화일보 2016년 1월 6일자 24면 9회 참조)

성균관대 교수
[ 많이 본 기사 ]
▶ 文 계승하려다 자기 색깔 못보여준 이낙연… 속타는 지지..
▶ 생후 하루 된 아기, 집에서 개에 물려 참변
▶ ‘같이 갑시다!’를 中대사관서 건배사로 외친 與의원
▶ 도넘는 ‘秋·尹공방’에도 침묵… 文대통령에겐 계획이 있다..
▶ 공해·도둑·뱀 없다는 울릉도에 뱀 출몰…어디서 왔나
Copyrightⓒmunhwa.com '대한민국 오후를 여는 유일석간 문화일보' 무단 전재 및 재배포 금지
[ 구독신청:02-3701-5555 / 모바일 웹 : m.munhwa.com ]
親文적자 김경수 최대복병…정세균..
피격 공무원 형 “청와대, 어떤 지시했..
국민연금, LG화학 배터리 분할에 ‘반..
이건희 회장 28일 영결식…“사업장·집..
사전투표 6200만명 돌파… 선거 당일..
topnews_photo 취임 60일… 임기 3분의 1 소화수도권에서 이재명 지사에 밀려親文 껴안기 위해 文 정책 계승부동산정책 등 직접 챙기기 나서現정권과 차별화 분위기도 감지유력한 차기 대권 주자인 이낙연(사진) 더불어민주당 대표..
ㄴ 親文적자 김경수 최대복병…정세균 등판설도 무시못해
생후 하루 된 아기, 집에서 개에 물려 참변
추미애 “옵티머스 무혐의 감찰” 지시…사실상 尹 겨..
도넘는 ‘秋·尹공방’에도 침묵… 文대통령에겐 계획..
special news 아델, 45㎏ 감량 갸름 얼굴 눈길…“달라진 거 알..
다이어트에 성공한 영국 출신 가수 아델의 갸름해진 얼굴이 화제를 모으고 있다.미국 연예매체 ‘엔터테인..

“공수처장 비토 불용” 巨與의 입법독재
‘같이 갑시다!’를 中대사관서 건배사로 외친 與의원
30억원 주택 보유세 5년뒤 4천만원…올해보다 3배..
배우 이아현, 재미교포 사업가와 세 번째 이혼
공해·도둑·뱀 없다는 울릉도에 뱀 출몰…어디서..
‘조두순 만기 출소’ 앞두고 신상정보등록제 구멍 논란
[김병종의 시화기행]
“이젠 지쳤다”… 웃는 듯 울고 있는 광대의 고백
number 親文적자 김경수 최대복병…정세균 등판설..
피격 공무원 형 “청와대, 어떤 지시했나…정..
국민연금, LG화학 배터리 분할에 ‘반대’ 행사
이건희 회장 28일 영결식…“사업장·집무실 ..
김청, 데뷔 40년 만에 순백의 웨..
‘나훈아 사촌동생’ 나진기 “‘테스..
유승준, ‘비자발급 불허’ 강경화 ..
회사소개 | 광고안내 | 사업안내 | 이용안내 | 구독안내 | 독자참여 | 회원서비스 | 고충처리 | 개인정보취급방침 | 청소년보호정책(책임자:한형민) | Site Map
제호 : 문화일보 | 주소 : 서울시 중구 새문안로 22 | 등록번호 : 서울특별시 아01697 | 등록일자 : 2011년 7월 15일 | 발행·편집인 : 이병규 | 발행연월일 : 1997년 1월 1일
Copyright ⓒ 문화일보. All Rights Reserved. ☎ 02) 3701-5114